KIAA1896

Product ID	ORK00944
Accession No	AB067483
Description	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25, transcript variant 5
Clone name	fk06388
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3712 bp) Predicted protein sequence (568 aa)
HaloTag ORF Clone	FHC00944
Flexi ORF Clone	FXC00944
Source	Human fetal brain
Rouge ID	mKIAA1896 by Kazusa Mouse cDNA Project

Length: 3712 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1800 bp
Genome contig ID	gi89161216f_129793564
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAAAGCAGCCTTCTAATAAAGTTGTTTCAAAGCTG
Flanking genome sequence (117782 - 117831)	----+--------+--------+--------+--------+----* ATCATGGAGCCAGTATTTTTCTGACGGGGGCCTGGGTGGTCTGGGGGTGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	129893564	129911344	11	99.1	Perfect prediction

Length: 568 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH73135	2.6e-209	100.0	solute carrier ...	Homo sapiens
XP_001153081	1.9e-206	99.2	solute carrier ...	Pan troglodytes
XP_548442	2.4e-199	96.0	similar to solu...	Canis lupus fam...
AAH66998	1.4e-197	95.2	Slc25a25 protei...	Mus musculus
EAW87738	3.1e-176	99.3	solute carrier ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007915	5.9e-08	23.3	KIAA0446

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	164	237	PD000012	Calcium-binding EF-hand
FPrintScan	IPR002167	280	300	PR00928	Graves disease carrier protein
	IPR002067	288	301	PR00926	Mitochondrial carrier protein
	IPR002067	301	315	PR00926	Mitochondrial carrier protein
	IPR002167	305	325	PR00928	Graves disease carrier protein
	IPR002067	344	364	PR00926	Mitochondrial carrier protein
	IPR002167	363	387	PR00928	Graves disease carrier protein
	IPR002067	392	410	PR00926	Mitochondrial carrier protein
	IPR002167	415	436	PR00928	Graves disease carrier protein
	IPR002067	435	453	PR00926	Mitochondrial carrier protein
	IPR002067	483	505	PR00926	Mitochondrial carrier protein
HMMPfam	IPR002048	138	166	PF00036	Calcium-binding EF-hand
	IPR002048	169	197	PF00036	Calcium-binding EF-hand
	IPR001993	284	374	PF00153	Mitochondrial substrate carrier
	IPR001993	378	467	PF00153	Mitochondrial substrate carrier
	IPR001993	475	567	PF00153	Mitochondrial substrate carrier
HMMSmart	IPR002048	138	166	SM00054	Calcium-binding EF-hand
HMMSmart	IPR002048	169	197	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	134	164	PS50222	Calcium-binding EF-hand
	IPR002048	165	200	PS50222	Calcium-binding EF-hand
	IPR002048	225	248	PS50222	Calcium-binding EF-hand
	IPR001993	283	369	PS50920	Mitochondrial substrate carrier
	IPR001993	377	462	PS50920	Mitochondrial substrate carrier
	IPR001993	474	562	PS50920	Mitochondrial substrate carrier

Primer_f	CAGCAACAACATGGGCATCGT
Primer_r	ATTTGATGGCTGATTCGGGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-