KIAA0446

Product ID	ORK00539
Accession No	AB007915
Description	solute carrier family 25, member 44, transcript variant 1
Clone name	fk03072
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3461 bp) Predicted protein sequence (351 aa)
HaloTag ORF Clone	FHC00539
Flexi ORF Clone	FXC00539
Source	Human fetal brain
Rouge ID	mKIAA0446 by Kazusa Mouse cDNA Project
Note	We replaced hg00104, former representative clones for KIAA0446 with fk03072. (1999/12/23)

Length: 3461 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2360 bp
Genome contig ID	gi89161185f_154330544
PolyA signal sequence (ATTAAA,-25)	+--------+--------+----*----+---- CTGAAATGTAATTAAAAGTTTTTATTGAGCCCCCG
Flanking genome sequence (118668 - 118717)	----+--------+--------+--------+--------+----* AGCTTTGGCTTGCGCGTATTTTTCCGGTCGCGGACATCCCACCGCGCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	154430544	154449210	4	99.3	Perfect prediction

Length: 351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001113629	2.8e-149	99.7	similar to CG58...	Macaca mulatta
XP_547537	1.1e-136	92.3	similar to CG58...	Canis lupus fam...
BAG09741	1.5e-136	100.0	solute carrier ...	synthetic construct
Q96H78	1.8e-130	97.5	Solute carrier ...	Homo sapiens
Q5RD67	4.6e-130	97.2	Solute carrier ...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067483	1.9e-09	23.3	KIAA1896

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002113	83	104	PR00927	Adenine nucleotide translocator 1
	IPR002067	141	154	PR00926	Mitochondrial carrier protein
	IPR002113	190	211	PR00927	Adenine nucleotide translocator 1
	IPR002067	214	234	PR00926	Mitochondrial carrier protein
	IPR002067	272	290	PR00926	Mitochondrial carrier protein
	IPR002113	306	321	PR00927	Adenine nucleotide translocator 1
HMMPfam	IPR001993	48	134	PF00153	Mitochondrial substrate carrier
	IPR001993	137	233	PF00153	Mitochondrial substrate carrier
	IPR001993	258	344	PF00153	Mitochondrial substrate carrier
ProfileScan	IPR001993	47	129	PS50920	Mitochondrial substrate carrier
	IPR001993	136	239	PS50920	Mitochondrial substrate carrier
	IPR001993	257	339	PS50920	Mitochondrial substrate carrier

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	GAGAGTCTGCCTTTTCATTCC
Primer_r	ACTTCCATTCTCCCTAAACTG
PCR product length	117 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles