KIAA1897

Product ID	ORK06541
Accession No	AB067484
Description	pseudouridylate synthase 7 (putative)
Clone name	fk06538
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3220 bp) Predicted protein sequence (645 aa)
Source	Human fetal brain
Rouge ID	mKIAA1897 by Kazusa Mouse cDNA Project

Length: 3220 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1281 bp
Genome contig ID	gi89161213r_104784192
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTTATGTAAATAAATCAAATAAATATATCAAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGCAGATAAGAATCTTGACCTTGACTAAAGGTAAGGAACTAAATGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	104884192	104936130	15	99.6	Perfect prediction

Length: 645 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001089515	98.6	pseudouridylate...	Macaca mulatta
XP_527856	98.9	pseudouridylate...	Pan troglodytes
Q96PZ0	98.9	Pseudouridylate...	Homo sapiens
BAG54704	98.8	unnamed protein...	Homo sapiens
BAG52324	98.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001656	206	631	PF01142	tRNA pseudouridine synthase D
HMMTigr	IPR001656	238	632	TIGR00094	tRNA pseudouridine synthase D
ProfileScan	IPR011760	354	564	PS50984	TRUD
ScanRegExp	IPR001656	275	288	PS01268	tRNA pseudouridine synthase D

Primer_f	AAGAAGCCTACAGGGAAATGC
Primer_r	TGCAACGACTTCCCAGCTAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-