KIAA1972

Product ID	ORK00963
Accession No	AB075852
Description	ring finger and SPRY domain containing 1, transcript variant 1
Clone name	fk09334
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3473 bp) Predicted protein sequence (576 aa)
HaloTag ORF Clone	FHC00963
Flexi ORF Clone	FXC00963
Source	Human fetal brain
Rouge ID	mKIAA1972 by Kazusa Mouse cDNA Project

Length: 3473 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1499 bp
Genome contig ID	gi51511732f_55677755
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- GAAGAATAAAACATCTGTTGCCTTTTTTGACTAAG
Flanking genome sequence (154134 - 154183)	----+--------+--------+--------+--------+----* ATTTCACAACTTTCATTGGTGTATACTGCTAAGGTTCCAAGACATTATAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	55777755	55831887	15	99.5	Perfect prediction

Length: 576 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5R881	99.8	RING finger and...	Pongo abelii
BAG51341	99.8	unnamed protein...	Homo sapiens
Q95LP3	99.1	RING finger and...	Macaca fascicularis
XP_850920	97.2	similar to F16A...	Canis lupus fam...
AAI34576	96.9	RSPRY1 protein ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003877	358	482	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR003877	358	482	SM00449	SPla/RYanodine receptor SPRY
HMMSmart	IPR001841	527	561	SM00184	Zinc finger
ProfileScan	IPR001870	300	483	PS50188	B302
ProfileScan	IPR001841	527	562	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	MIVFGWAVFLASRSLGQGLLLTL	23	PRIMARY	23

Primer_f	CCAGTATTAGTGACCGGCTTG
Primer_r	GGTACTCGCTGACATCATTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-