Order Kazusa clone(s) from : ![]() |
Product ID | ORK04108 |
---|---|
Accession No | AB095935 |
Description | ankyrin repeat domain 18A |
Clone name | fk09763 |
Vector information | |
cDNA sequence | DNA sequence (3681 bp) Predicted protein sequence (996 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 679 bp |
---|---|
Genome contig ID | gi89161216r_38461609 |
PolyA signal sequence (AATAAA,-10) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99754 - 99705) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 38561363 | 38610305 | 16 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 72 | 84 | PR01415 | Ankyrin |
IPR002110 | 183 | 195 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 43 | 70 | PF00023 | Ankyrin |
IPR002110 | 71 | 103 | PF00023 | Ankyrin | |
IPR002110 | 104 | 136 | PF00023 | Ankyrin | |
IPR002110 | 137 | 169 | PF00023 | Ankyrin | |
IPR002110 | 170 | 202 | PF00023 | Ankyrin | |
IPR002110 | 203 | 235 | PF00023 | Ankyrin | |
HMMSmart | IPR002110 | 71 | 100 | SM00248 | Ankyrin |
IPR002110 | 104 | 133 | SM00248 | Ankyrin | |
IPR002110 | 137 | 166 | SM00248 | Ankyrin | |
IPR002110 | 170 | 199 | SM00248 | Ankyrin | |
IPR002110 | 203 | 232 | SM00248 | Ankyrin | |
IPR002110 | 236 | 265 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 42 | 259 | PS50297 | Ankyrin |
IPR002110 | 71 | 103 | PS50088 | Ankyrin | |
IPR002110 | 104 | 136 | PS50088 | Ankyrin | |
IPR002110 | 137 | 169 | PS50088 | Ankyrin | |
IPR002110 | 170 | 202 | PS50088 | Ankyrin |
![]() |
Primer_f | TGACAGACTAAACAGGACACC |
---|---|
Primer_r | GCATAATGGAGAGCAGTGTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |