KIAA2015

Product ID	ORK04108
Accession No	AB095935
Description	ankyrin repeat domain 18A
Clone name	fk09763
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3681 bp) Predicted protein sequence (996 aa)
Source	Human fetal brain

Length: 3681 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	679 bp
Genome contig ID	gi89161216r_38461609
PolyA signal sequence (AATAAA,-10)	+--------+--------+----*----+---- TCTACATGGAGAAATAAAACCAATAAATAAAGGAG
Flanking genome sequence (99754 - 99705)	----+--------+--------+--------+--------+----* AAGGGAAAGCTCATGATTCTGGTGCTCCAGTTCCCCAAGATTAGGCCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	38561363	38610305	16	99.6	Perfect prediction

Length: 996 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52435	100.0	ANKRD18A protei...	Homo sapiens
Q8IVF6	99.6	Ankyrin repeat ...	Homo sapiens
XP_001726157	99.4	ankyrin repeat ...	Homo sapiens
EAW58249	98.8	hCG2010829 [Hom...	Homo sapiens
XP_001717672	98.7	similar to hCG2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011137	4.2e-15	32.0	KIAA0565
AB028997	1.7e-14	42.5	KIAA1074
AB046861	4.8e-13	32.8	KIAA1641
AB037755	1.1e-06	21.8	KIAA1334
AB046781	9.9e-05	21.7	KIAA1561

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	72	84	PR01415	Ankyrin
FPrintScan	IPR002110	183	195	PR01415	Ankyrin
HMMPfam	IPR002110	43	70	PF00023	Ankyrin
	IPR002110	71	103	PF00023	Ankyrin
	IPR002110	104	136	PF00023	Ankyrin
	IPR002110	137	169	PF00023	Ankyrin
	IPR002110	170	202	PF00023	Ankyrin
	IPR002110	203	235	PF00023	Ankyrin
HMMSmart	IPR002110	71	100	SM00248	Ankyrin
	IPR002110	104	133	SM00248	Ankyrin
	IPR002110	137	166	SM00248	Ankyrin
	IPR002110	170	199	SM00248	Ankyrin
	IPR002110	203	232	SM00248	Ankyrin
	IPR002110	236	265	SM00248	Ankyrin
ProfileScan	IPR002110	42	259	PS50297	Ankyrin
	IPR002110	71	103	PS50088	Ankyrin
	IPR002110	104	136	PS50088	Ankyrin
	IPR002110	137	169	PS50088	Ankyrin
	IPR002110	170	202	PS50088	Ankyrin

Primer_f	TGACAGACTAAACAGGACACC
Primer_r	GCATAATGGAGAGCAGTGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-