Gene/Protein Characteristic Table for KIAA2026
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05748
Accession No AB095946
Description KIAA2026
Clone name fk11517
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3246 bp)
Predicted protein sequence (858 aa)
Source Human fetal brain
Rouge ID mKIAA2026 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3246 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 669 bp
Genome contig ID gi89161216r_5809023
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CAGAAGAATCTGCATGTAATAAACTGAGTTGCTGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCTTTGTTTGAATACCATTTTTAACGTGTGTTCTTGTTCCATTGAAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 r 5909023 5912260 1 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 858 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_001017969 0 100.0 hypothetical pr...
Homo sapiens
XP_001108823 0 96.2 similar to K06A...
Macaca mulatta
XP_001917272 0 86.1 similar to K06A...
Equus caballus
XP_874176 0 82.1 similar to K06A...
Bos taurus
XP_219779 5e-162 70.9 similar to Y40C...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GCATATGTTAAGACTCCAGAG
Primer_r AATTGATGGTATAGCTGGCAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp