KIAA0009

Product ID	ORK06049
Accession No	D13634
Description	mitochondrial fission regulator 1
Clone name	ha00176
Vector information	The cDNA fragment was cloned by use of ZAP-cDNA synthesis ki ... The cDNA fragment was cloned by use of ZAP-cDNA synthesis kit and inserted at the EcoRI-XhoI site of the pNTT104 vector (GenBank Accession No. AB032066, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRI adapter (5'AATTCGGCAC GAG3') and inserted at the EcoRI site of the vector. The 3' end of the cDNA was inserted at the XhoI site of the vector.
cDNA sequence	DNA sequence (2480 bp) Predicted protein sequence (319 aa)
Source	Myeloblast cell line (KG-1)

Length: 2480 bp

Physical map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1518 bp
Genome contig ID	gi51511724f_66657141
PolyA signal sequence (AATAAA,-33)	+--------+--------+----*----+---- AAAATAAAGCAAACTAACTGTTTTATTTTCCTTGG
Flanking genome sequence (128211 - 128260)	----+--------+--------+--------+--------+----* ACCATAGTGCTTCCATTTTTTCTTTTTTCACAATAGGTAAGATTCTTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	f	66744782	66785350	7	99.4	Perfect prediction

Length: 319 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Entry	Exp	ID%	Protein	Source

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007972	6	237	PF05308	Protein of unknown function DUF729

Expression profile

Northern blot

Experimental conditions

RH mapping information

Chromosome No. 8

Experimental conditions

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp