KIAA0071

Product ID	ORK06618
Accession No	D31888
Description	REST corepressor 1
Clone name	ha00472
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5241 bp) Predicted protein sequence (396 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0071 by Kazusa Mouse cDNA Project

Length: 5241 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4050 bp
Genome contig ID	gi51511730f_102029355
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GAGGGGTTAAATAAAAATTTTCAAGCCATTGATGT
Flanking genome sequence (237291 - 237340)	----+--------+--------+--------+--------+----* AATAAAATATGAAATGAAAGCATTTTCTGCACCCCCACGCTCCATCAAAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	102129244	102266644	12	99.2	Perfect prediction

Length: 396 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UKL0	2.9e-150	100.0	REST corepresso...	Homo sapiens
EAW81793	2.9e-150	100.0	REST corepresso...	Homo sapiens
EAW81794	7.7e-146	100.0	REST corepresso...	Homo sapiens
Q8CFE3	2.3e-145	96.2	REST corepresso...	Mus musculus
XP_001927812	7.1e-145	95.5	similar to REST...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037764	2.8e-40	64.4	KIAA1343
AB028970	1.6e-10	25.8	KIAA1047
AB033092	0.00054	26.6	KIAA1266

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000949	14	78	PF01448	ELM2
	IPR014778	103	148	PF00249	Myb
	IPR014778	294	339	PF00249	Myb
HMMSmart	IPR001005	102	150	SM00717	SANT
HMMSmart	IPR001005	293	341	SM00717	SANT
ProfileScan	IPR000949	14	100	PS51156	ELM2

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GTTTCCTCAGATACCACAGAC
Primer_r	GAGCATCGCACAGGACCACTA
PCR product length	337 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles