KIAA0016

Product ID	ORK00364
Accession No	D13641
Description	translocase of outer mitochondrial membrane 20 homolog (yeast)
Clone name	ha00489
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3259 bp) Predicted protein sequence (178 aa)
HaloTag ORF Clone	FHC00364
Flexi ORF Clone	FXC00364
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0016 by Kazusa Mouse cDNA Project

Length: 3259 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2720 bp
Genome contig ID	gi89161185r_233239283
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- CTCAACTGTTTAAGTGAATATTAAAGGGCTTGGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTTTGGCTTGGCGTATGTTTGGAGAAGTGAACTCTGCTGAATTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	233339283	233358754	5	99.1	Perfect prediction

Length: 178 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15388	3.4e-55	100.0	Mitochondrial i...	Homo sapiens
CAG32999	6.3e-55	99.3	TOMM20 [Homo sa...	Homo sapiens
Q9DCC8	6.3e-55	99.3	Mitochondrial i...	Mus musculus
ABW03358	1.2e-54	99.3	translocase of ...	synthetic construct
XP_001491687	1.2e-54	99.3	similar to Mito...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002056	53	70	PR00351	Protein import receptor MAS20
FPrintScan	IPR002056	71	83	PR00351	Protein import receptor MAS20
HMMPfam	IPR002056	30	175	PF02064	Protein import receptor MAS20
HMMTigr	IPR002056	34	160	TIGR00985	Protein import receptor MAS20

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GCGAAAGAACATTGAAAACA
Primer_r	GCAGGTGGGAGGATGGTAAA
PCR product length	187 bp
PCR conditions	95 °C15 sec58 °C60 sec30 cycles