KIAA0044

Product ID	ORK01954
Accession No	D26445
Description	protein phosphatase 2, regulatory subunit B', gamma
Clone name	ha00492
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3702 bp) Predicted protein sequence (484 aa)
HaloTag ORF Clone	FHC01954
Flexi ORF Clone	FXC01954
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0044 by Kazusa Mouse cDNA Project

Length: 3702 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2247 bp
Genome contig ID	gi51511730f_101246036
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- ACATTGGAAATAAACCGGTGACTGTTTTTCTTCAT
Flanking genome sequence (217575 - 217624)	----+--------+--------+--------+--------+----* AAAGTTCTGCGTTTGGCATCTTCACTCTTTCCAAAATGTATCTGTACATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	101346036	101463609	13	99.4	Perfect prediction

Length: 484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW81755	2.2e-202	100.0	protein phospha...	Homo sapiens
XP_001489084	1.4e-199	98.8	protein phospha...	Equus caballus
XP_537555	8.3e-199	98.6	similar to gamm...	Canis lupus fam...
BAG72712	2e-198	100.0	protein phospha...	synthetic construct
AAL14778	9e-198	99.8	PP2A B56 gamma ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002554	25	437	PF01603	Protein phosphatase 2A

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ACCCCGTTCCGTAGGCAATAA
Primer_r	GTGCTTTCCTATCGCTCTGAC
PCR product length	183 bp
PCR conditions	95 °C15 sec63 °C60 sec30 cycles