KIAA0125

Product ID	ORK05583
Accession No	D50915
Description	Very putative protein KIAA0125.
Clone name	ha00502
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7883 bp) Predicted protein sequence (109 aa)
Source	Myeloblast cell line (KG-1)

Length: 7883 bp

Physical map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	7089 bp
Genome contig ID	gi51511730f_105361657
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- AACAGTCTATTTGCTTTACATTAAATTTGTAGGCT
Flanking genome sequence (107890 - 107939)	----+--------+--------+--------+--------+----* AATTTGTGTACCTTCAGAGTGTGAAAGTTTTCTCCTGAGGAAAATGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	105461657	105469545	1	99.0	Perfect prediction

Length: 109 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

No significant homologues

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Chromosome No. 14

Experimental conditions