Gene/Protein Characteristic Table for KIAA0054
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07717
Accession No D29677
Description helicase with zinc finger
Clone name ha00503s1
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (6274 bp)
Predicted protein sequence (1943 aa)
Flexi ORF Clone FXC07717
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0054 by Kazusa Mouse cDNA Project
Note We replaced ha00503, former representative clones for KIAA0054 with ha00503s1. (2008/8/27)
Features of the cloned cDNA sequence
Description

Length: 6274 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 300 bp
Genome contig ID gi51511734r_62404529
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAAGCTAGCAGCCAAGAGGTTAATTGTGCAACTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAGAAAAGTTTGTCTAAAATGTATTTAAAAAGAAA
Features of the protein sequence
Description

Length: 1943 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW89023 0 100.0 helicase with z...
Homo sapiens
AAI30583 0 99.9 Helicase with z...
Homo sapiens
P42694 0 99.9 Probable helica...
Homo sapiens
AAI44084 0 99.9 HELZ protein [H...
Homo sapiens
XP_001163943 0 99.7 helicase with z...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB051556 3e-15 40.7 KIAA1769
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000571 180 206 PF00642 Zinc finger
IPR009818 1096 1113 PF07145 Ataxin-2
HMMSmart IPR000571 179 206 SM00356 Zinc finger
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name Genebridge 4
Primer_f TAACAAGCAGATCGCGGA
Primer_r GGTCGCTACTCTTCTTGG
PCR product length 143 bp
PCR conditions 95 °C15 sec56 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp