KIAA0028

Product ID	ORK00374
Accession No	D21851
Description	leucyl-tRNA synthetase 2, mitochondrial
Clone name	ha00560
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4203 bp) Predicted protein sequence (904 aa)
HaloTag ORF Clone	FHC00374
Flexi ORF Clone	FXC00374
Source	Myeloblast cell line (KG-1)

Length: 4203 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1306 bp
Genome contig ID	gi89161205f_45305079
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTTTTTTAGTGTAATAAAATGTTTATCATCTATG
Flanking genome sequence (260255 - 260304)	----+--------+--------+--------+--------+----* ACTTCAGGACATATGTGTGATCCTGGAATACACCATATTCCAATTTCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	45405079	45565332	22	99.9	Perfect prediction

Length: 904 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15031	100.0	Probable leucyl...	Homo sapiens
XP_001147524	99.7	leucyl-tRNA syn...	Pan troglodytes
Q5RDP4	99.2	Probable leucyl...	Pongo abelii
XP_001114552	96.0	leucyl-tRNA syn...	Macaca mulatta
XP_001500886	92.5	similar to Prob...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037773	0.00028	26.4	KIAA1352

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002302	177	194	PR00985	Leucyl-tRNA synthetase
	IPR002302	203	219	PR00985	Leucyl-tRNA synthetase
	IPR002302	236	249	PR00985	Leucyl-tRNA synthetase
	IPR002302	265	284	PR00985	Leucyl-tRNA synthetase
	IPR002302	516	534	PR00985	Leucyl-tRNA synthetase
	IPR002302	555	577	PR00985	Leucyl-tRNA synthetase
	IPR002302	588	598	PR00985	Leucyl-tRNA synthetase
HMMPfam	IPR015413	85	167	PF09334	Aminoacyl-tRNA synthetase
	IPR002300	640	680	PF00133	Aminoacyl-tRNA synthetase
	IPR013155	726	872	PF08264	Valyl/Leucyl/Isoleucyl-tRNA synthetase
HMMTigr	IPR002302	55	903	TIGR00396	Leucyl-tRNA synthetase
ScanRegExp	IPR001412	92	103	PS00178	Aminoacyl-tRNA synthetase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GGGAAGCCATCAGAGACACT
Primer_r	CTGAAGGCAAAGAGACCATT
PCR product length	216 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles