KIAA0110

Product ID	ORK00019
Accession No	D14811
Description	MAD2L1 binding protein, transcript variant 2
Clone name	ha00666
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1233 bp) Predicted protein sequence (275 aa)
HaloTag ORF Clone	FHC00019
Flexi ORF Clone	FXC00019
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0110 by Kazusa Mouse cDNA Project

Length: 1233 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	405 bp
Genome contig ID	gi89161210f_43611588
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TATGAACTTAAATATAAAATAAATAGATTCTTATT
Flanking genome sequence (105067 - 105116)	----+--------+--------+--------+--------+----* ATATTTTCCTGAAATTGTTTTGACTTAACTTGTCAGGTTTTAGGCTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	43711588	43716653	3	100.0	Perfect prediction

Length: 275 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG59665	4.8e-121	99.6	unnamed protein...	Homo sapiens
CAG33174	8.6e-121	99.6	MAD2L1BP [Homo ...	Homo sapiens
XP_518498	7e-120	98.9	MAD2L1 binding ...	Pan troglodytes
XP_001096335	1.3e-116	95.3	MAD2L1 binding ...	Macaca mulatta
NP_001003690	3.5e-115	98.9	MAD2L1 binding ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	2	275	PD125087	NULL
HMMPfam	IPR009511	10	275	PF06581	MAD2L1 binding protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GCTGTGACTGTGACTGTAATC
Primer_r	CACAGCAAAGAGCAGAAAGGG
PCR product length	159 bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles