KIAA0104

Product ID	ORK01959
Accession No	D14660
Description	mitochondrial ribosomal protein L19
Clone name	ha00685
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1322 bp) Predicted protein sequence (291 aa)
HaloTag ORF Clone	FHC01959
Flexi ORF Clone	FXC01959
Source	Myeloblast cell line (KG-1)

Length: 1322 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	445 bp
Genome contig ID	gi89161199f_75627444
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATGTAGGAATGTTAAGAAATAAAACATTTAATAAG
Flanking genome sequence (108922 - 108971)	----+--------+--------+--------+--------+----* ATCTCAGAAGACTCCAGTAAATCTGCAATTGTATCTCTCTCCTTTTTAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	75727444	75736364	6	100.0	Perfect prediction

Length: 291 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P49406	6.8e-113	100.0	39S ribosomal p...	Homo sapiens
XP_515568	1.2e-112	99.7	mitochondrial r...	Pan troglodytes
Q5R8M4	6.8e-107	96.2	39S ribosomal p...	Pongo abelii
XP_001112069	7.9e-105	93.5	mitochondrial r...	Macaca mulatta
XP_001498647	4.6e-93	84.2	similar to Mito...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001857	108	191	PD002979	Ribosomal protein L19
FPrintScan	IPR001857	123	152	PR00061	Ribosomal protein L19
FPrintScan	IPR001857	153	176	PR00061	Ribosomal protein L19

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ATACTTACGAGATGCCCTTCC
Primer_r	TTAGACCAGGGCTTAGGCTTC
PCR product length	129 (0.3k) bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles