KIAA0042

Product ID	ORK01049
Accession No	D26361
Description	kinesin family member 14, transcript variant 1
Clone name	ha00930
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6586 bp) Predicted protein sequence (1652 aa)
HaloTag ORF Clone	FHC01049
Flexi ORF Clone	FXC01049
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0042 by Kazusa Mouse cDNA Project

Length: 6586 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1200 bp
Genome contig ID	gi89161185r_198687930
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGATATTGAGCAGTTCCTAAAGAATAATTCATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAGAAGAAAAAAAAAGAAGAATTCATTTAAATAACCTGATCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	198787930	198856485	30	99.7	Perfect prediction

Length: 1652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15058	100.0	Kinesin-like pr...	Homo sapiens
AAI13743	99.9	Kinesin family ...	Homo sapiens
EAW91317	99.9	kinesin family ...	Homo sapiens
XP_001109736	93.1	kinesin family ...	Macaca mulatta
XP_547369	81.3	similar to Kine...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046810	3.6e-54	40.9	KIAA1590
AB014539	3.7e-48	36.8	KIAA0639
AB014606	1.3e-39	42.1	KIAA0706
AB040881	2.4e-39	36.2	KIAA1448
AB011163	4.5e-38	34.4	KIAA0591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	442	463	PR00380	Kinesin
	IPR001752	565	582	PR00380	Kinesin
	IPR001752	602	620	PR00380	Kinesin
	IPR001752	655	676	PR00380	Kinesin
HMMPfam	IPR001752	368	706	PF00225	Kinesin
HMMPfam	IPR000253	829	895	PF00498	Forkhead-associated
HMMSmart	IPR001752	360	713	SM00129	Kinesin
HMMSmart	IPR000253	828	880	SM00240	Forkhead-associated
ProfileScan	IPR001752	359	632	PS50067	Kinesin
ScanRegExp	IPR001752	601	612	PS00411	Kinesin

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CCAAAGAAGAACACCAACAAT
Primer_r	CACACCCACTGAATCCTACTG
PCR product length	145 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles