KIAA0034

Product ID	ORK04587
Accession No	D21260
Description	clathrin, heavy chain (Hc), transcript variant 1
Clone name	ha00931
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6111 bp) Predicted protein sequence (1685 aa)
HaloTag ORF Clone	FHC04587
Flexi ORF Clone	FXC04587
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0034 by Kazusa Mouse cDNA Project

Length: 6111 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	911 bp
Genome contig ID	gi51511734f_54952103
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTACTCAAATTTAAAATAAATTACTGGACTGTGG
Flanking genome sequence (174805 - 174854)	----+--------+--------+--------+--------+----* AAATAACATAGAATTGAAGTTTTAATTAAATACCACTCAAACGAAAAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	55052103	55126906	32	99.8	Perfect prediction

Length: 1685 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q00610	100.0	Clathrin heavy ...	Homo sapiens
XP_537700	99.9	similar to Clat...	Canis lupus fam...
Q68FD5	99.9	Clathrin heavy ...	Mus musculus
P49951	99.9	Clathrin heavy ...	Bos taurus
XP_001135961	99.9	clathrin heavy ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001473	29	66	PF01394	Clathrin propeller
	IPR001473	70	104	PF01394	Clathrin propeller
	IPR001473	112	143	PF01394	Clathrin propeller
	IPR001473	158	197	PF01394	Clathrin propeller
	IPR001473	208	244	PF01394	Clathrin propeller
	IPR001473	263	298	PF01394	Clathrin propeller
	IPR001473	306	340	PF01394	Clathrin propeller
	IPR015348	341	364	PF09268	Clathrin
	IPR000547	547	689	PF00637	Clathrin
	IPR000547	696	838	PF00637	Clathrin
	IPR000547	843	982	PF00637	Clathrin
	IPR000547	989	1134	PF00637	Clathrin
	IPR000547	1138	1279	PF00637	Clathrin
	IPR000547	1284	1430	PF00637	Clathrin
	IPR000547	1433	1576	PF00637	Clathrin
HMMSmart	IPR000547	547	689	SM00299	Clathrin
	IPR000547	696	838	SM00299	Clathrin
	IPR000547	843	982	SM00299	Clathrin
	IPR000547	989	1134	SM00299	Clathrin
	IPR000547	1138	1279	SM00299	Clathrin
	IPR000547	1284	1430	SM00299	Clathrin
	IPR000547	1433	1592	SM00299	Clathrin

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGCTTTGGAGCTTGTCTG
Primer_r	ATGACCTGGATGAAATAG
PCR product length	116 bp
PCR conditions	95 °C15 sec52 °C60 sec30 cycles