KIAA0051

Product ID	ORK01050
Accession No	D29640
Description	IQ motif containing GTPase activating protein 1
Clone name	ha00940
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6379 bp) Predicted protein sequence (1678 aa)
HaloTag ORF Clone	FHC01050
Flexi ORF Clone	FXC01050
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0051 by Kazusa Mouse cDNA Project

Length: 6379 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1281 bp
Genome contig ID	gi51511731f_88632454
PolyA signal sequence (GATAAA,-20)	+--------+--------+----*----+---- AAGCTTTTGTTCTTGGATAAAAAGTCATACACTTT
Flanking genome sequence (213173 - 213222)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACTTTTTCCAGGAAAATATATTGAAATCATGCTGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	88732454	88845625	38	100.0	Perfect prediction

Length: 1678 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_523157	99.9	IQ motif contai...	Pan troglodytes
P46940	100.0	Ras GTPase-acti...	Homo sapiens
AAI39732	99.9	IQ motif contai...	Homo sapiens
XP_536199	97.0	similar to Ras ...	Canis lupus fam...
XP_001498595	95.8	similar to Ras ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000593	1477	1677	PD008735	RasGAP protein
HMMPfam	IPR001715	66	181	PF00307	Calponin-like actin-binding
	IPR001202	702	731	PF00397	WW/Rsp5/WWP
	IPR000048	767	787	PF00612	IQ calmodulin-binding region
	IPR000048	797	817	PF00612	IQ calmodulin-binding region
	IPR000048	827	847	PF00612	IQ calmodulin-binding region
	IPR000048	857	877	PF00612	IQ calmodulin-binding region
	IPR001936	1046	1258	PF00616	Ras GTPase-activating protein
	IPR000593	1472	1604	PF03836	RasGAP protein
HMMSmart	IPR001715	67	176	SM00033	Calponin-like actin-binding
	IPR001202	701	733	SM00456	WW/Rsp5/WWP
	IPR000048	765	787	SM00015	IQ calmodulin-binding region
	IPR000048	795	817	SM00015	IQ calmodulin-binding region
	IPR000048	825	847	SM00015	IQ calmodulin-binding region
	IPR000048	855	877	SM00015	IQ calmodulin-binding region
	IPR001936	1013	1366	SM00323	Ras GTPase-activating protein
ProfileScan	IPR001715	65	180	PS50021	Calponin-like actin-binding
	IPR001202	700	733	PS50020	WW/Rsp5/WWP
	IPR000048	766	795	PS50096	IQ calmodulin-binding region
	IPR000048	796	825	PS50096	IQ calmodulin-binding region
	IPR000048	826	855	PS50096	IQ calmodulin-binding region
	IPR000048	856	885	PS50096	IQ calmodulin-binding region
	IPR001936	1025	1258	PS50018	Ras GTPase-activating protein
ScanRegExp	IPR001202	706	731	PS01159	WW/Rsp5/WWP
ScanRegExp	IPR001936	1210	1224	PS00509	Ras GTPase-activating protein

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GCTACAGTATGAAGGAGTTGC
Primer_r	TGTGGCATCGGGAGTGTATCA
PCR product length	237 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles