Order Kazusa clone(s) from : ![]() |
Product ID | ORK00393 |
---|---|
Accession No | D31891 |
Description | SET domain, bifurcated 1, transcript variant 1 |
Clone name | ha01038 |
Vector information | |
cDNA sequence | DNA sequence (4333 bp) Predicted protein sequence (1300 aa) |
HaloTag ORF Clone |
FHC00393
![]() |
Flexi ORF Clone | FXC00393 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0067
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 371 bp |
---|---|
Genome contig ID | gi89161185f_149065543 |
PolyA signal sequence (GATAAA,-9) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (138294 - 138343) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 149165543 | 149203835 | 22 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001739 | 603 | 677 | PF01429 | Methyl-CpG binding |
IPR007728 | 690 | 804 | PF05033 | Pre-SET zinc-binding region | |
IPR001214 | 806 | 1282 | PF00856 | SET | |
HMMSmart | IPR002999 | 265 | 327 | SM00333 | Tudor |
IPR002999 | 355 | 410 | SM00333 | Tudor | |
IPR001739 | 606 | 681 | SM00391 | Methyl-CpG binding | |
IPR003606 | 688 | 795 | SM00468 | Pre-SET zinc-binding sub-group | |
IPR001214 | 812 | 1281 | SM00317 | SET | |
ProfileScan | IPR001739 | 603 | 674 | PS50982 | Methyl-CpG binding |
IPR007728 | 736 | 809 | PS50867 | Pre-SET zinc-binding region | |
IPR001214 | 811 | 1279 | PS50280 | SET | |
IPR003616 | 1284 | 1300 | PS50868 | Post-SET zinc-binding region |
Panel name | Genebridge 4 |
---|---|
Primer_f | ACCCCTGAGTTGTGAGTCTGG |
Primer_r | ATCCAAACCAATGCACCCAGG |
PCR product length | 109 (1.4K) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |