KIAA0067

Product ID	ORK00393
Accession No	D31891
Description	SET domain, bifurcated 1, transcript variant 1
Clone name	ha01038
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4333 bp) Predicted protein sequence (1300 aa)
HaloTag ORF Clone	FHC00393
Flexi ORF Clone	FXC00393
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0067 by Kazusa Mouse cDNA Project

Length: 4333 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	371 bp
Genome contig ID	gi89161185f_149065543
PolyA signal sequence (GATAAA,-9)	+--------+--------+----*----+---- ATTTCTTGAAAGTCTTTTAACAATATGATAAAACT
Flanking genome sequence (138294 - 138343)	----+--------+--------+--------+--------+----* AAGATTGTGGTTTTGTTTCTCTCTCTCAGCCCGATACTCCCAATTCTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	149165543	149203835	22	100.0	Perfect prediction

Length: 1300 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q15047	100.0	Histone-lysine ...	Homo sapiens
XP_524864	99.5	SET domain, bif...	Pan troglodytes
EAW53505	99.8	SET domain, bif...	Homo sapiens
EAW53506	99.9	SET domain, bif...	Homo sapiens
AAH28671	99.8	SET domain, bif...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001739	603	677	PF01429	Methyl-CpG binding
	IPR007728	690	804	PF05033	Pre-SET zinc-binding region
	IPR001214	806	1282	PF00856	SET
HMMSmart	IPR002999	265	327	SM00333	Tudor
	IPR002999	355	410	SM00333	Tudor
	IPR001739	606	681	SM00391	Methyl-CpG binding
	IPR003606	688	795	SM00468	Pre-SET zinc-binding sub-group
	IPR001214	812	1281	SM00317	SET
ProfileScan	IPR001739	603	674	PS50982	Methyl-CpG binding
	IPR007728	736	809	PS50867	Pre-SET zinc-binding region
	IPR001214	811	1279	PS50280	SET
	IPR003616	1284	1300	PS50868	Post-SET zinc-binding region

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACCCCTGAGTTGTGAGTCTGG
Primer_r	ATCCAAACCAATGCACCCAGG
PCR product length	109 (1.4K) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles