KIAA0163

Product ID	ORK00438
Accession No	D79985
Description	DiGeorge syndrome critical region gene 2, transcript variant 1
Clone name	ha01059
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4436 bp) Predicted protein sequence (550 aa)
HaloTag ORF Clone	FHC00438
Flexi ORF Clone	FXC00438
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0163 by Kazusa Mouse cDNA Project

Length: 4436 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2598 bp
Genome contig ID	gi89161203r_17303801
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TCATCCAAATGCCAAATAAACTTGTGTTCCGGGAG
Flanking genome sequence (99997 - 99948)	----+--------+--------+--------+--------+----* AGGCATGGTTAGTCCTTGGTGTGGCCCCCACGGCTGCCACAGGCTAAGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	r	17403798	17489904	11	99.2	Internal No-hit

Length: 550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH40500	0	99.8	DiGeorge syndro...	Homo sapiens
ABM85086	0	99.8	DiGeorge syndro...	synthetic construct
CAH92561	0	98.9	hypothetical pr...	Pongo abelii
XP_530360	0	99.1	integral membra...	Pan troglodytes
XP_001489116	8.7e-210	93.1	similar to Inte...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002172	28	66	PF00057	Low density lipoprotein-receptor
HMMSmart	IPR002172	29	68	SM00192	Low density lipoprotein-receptor
	IPR001304	115	266	SM00034	C-type lectin
	IPR001007	271	332	SM00214	von Willebrand factor
ProfileScan	IPR002172	29	67	PS50068	Low density lipoprotein-receptor
ProfileScan	IPR001304	124	266	PS50041	C-type lectin
ScanRegExp	IPR002172	44	66	PS01209	Low density lipoprotein-receptor
ScanRegExp	IPR001007	293	332	PS01208	von Willebrand factor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	4	KADSGAFLLLFLLVLTVTEPLRP	26	PRIMARY	23
SOSUI2	2	348	MRLVVSCISSFLILSLLLFMVH	369	PRIMARY	22

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GACTCGCTCATCTGTTCTTGC
Primer_r	CAGTATCAAATCCCACCTCCG
PCR product length	205 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles