KIAA0130

Product ID	ORK05962
Accession No	D50920
Description	mediator complex subunit 24
Clone name	ha01208
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3468 bp) Predicted protein sequence (1006 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0130 by Kazusa Mouse cDNA Project

Length: 3468 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	425 bp
Genome contig ID	gi51511734r_35328881
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GTTCATGTATAAATAAAGCTCCTCGTGGCTCCCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTGACTGTGTGTGCTGTTGGTATTGGTGCCACCCGGGGCAGGGCATAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	35428881	35464175	26	99.8	Perfect prediction

Length: 1006 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW60629	99.8	thyroid hormone...	Homo sapiens
XP_511466	99.8	thyroid hormone...	Pan troglodytes
EAW60631	99.8	thyroid hormone...	Homo sapiens
XP_001170999	99.8	thyroid hormone...	Pan troglodytes
BAG11138	100.0	thyroid hormone...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	629	KVCSLAVCAVAWLVAHVRMLG	649	PRIMARY	21

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCCTGCTCATCTCCTCCATCC
Primer_r	GACACCTTCACCAGTTCCGAC
PCR product length	163 (0.3k) bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles