KIAA0150

Product ID	ORK00430
Accession No	D63484
Description	zinc finger CCCH-type containing 3
Clone name	ha01348
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3231 bp) Predicted protein sequence (944 aa)
HaloTag ORF Clone	FHC00430
Flexi ORF Clone	FXC00430
Source	Myeloblast cell line (KG-1)

Length: 3231 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	395 bp
Genome contig ID	gi51511724r_144490974
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GGTGTTTTATGTTCAGCAATAAAGGTTCTATCCGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGGTTGGCTTGTCCTGACTGTTGCCATGCCACCGCCAGGCGGAAAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	144590974	144694723	12	99.6	Perfect prediction

Length: 944 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09625	100.0	zinc finger CCC...	synthetic construct
NP_055932	99.7	zinc finger CCC...	Homo sapiens
EAW82249	99.7	zinc finger CCC...	Homo sapiens
Q8IXZ2	99.4	Zinc finger CCC...	Homo sapiens
AAH38670	98.9	Zinc finger CCC...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000571	664	690	PF00642	Zinc finger
	IPR000571	691	717	PF00642	Zinc finger
	IPR000571	720	744	PF00642	Zinc finger
	IPR000571	747	772	PF00642	Zinc finger
	IPR000571	773	795	PF00642	Zinc finger
HMMSmart	IPR000571	664	690	SM00356	Zinc finger
	IPR000571	691	717	SM00356	Zinc finger
	IPR000571	719	744	SM00356	Zinc finger
	IPR000571	746	772	SM00356	Zinc finger
	IPR000571	773	795	SM00356	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GATGACTACAAAACCCTCCAC
Primer_r	CACGAGGGAGTATTTCTTGCG
PCR product length	177 bp
PCR conditions	95 °C15 sec64 °C60 sec35 cycles