Order Kazusa clone(s) from : ![]() |
Product ID | ORK00430 |
---|---|
Accession No | D63484 |
Description | zinc finger CCCH-type containing 3 |
Clone name | ha01348 |
Vector information | |
cDNA sequence | DNA sequence (3231 bp) Predicted protein sequence (944 aa) |
HaloTag ORF Clone |
FHC00430
![]() |
Flexi ORF Clone | FXC00430 |
Source | Myeloblast cell line (KG-1) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 395 bp |
---|---|
Genome contig ID | gi51511724r_144490974 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | r | 144590974 | 144694723 | 12 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000571 | 664 | 690 | PF00642 | Zinc finger |
IPR000571 | 691 | 717 | PF00642 | Zinc finger | |
IPR000571 | 720 | 744 | PF00642 | Zinc finger | |
IPR000571 | 747 | 772 | PF00642 | Zinc finger | |
IPR000571 | 773 | 795 | PF00642 | Zinc finger | |
HMMSmart | IPR000571 | 664 | 690 | SM00356 | Zinc finger |
IPR000571 | 691 | 717 | SM00356 | Zinc finger | |
IPR000571 | 719 | 744 | SM00356 | Zinc finger | |
IPR000571 | 746 | 772 | SM00356 | Zinc finger | |
IPR000571 | 773 | 795 | SM00356 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | GATGACTACAAAACCCTCCAC |
Primer_r | CACGAGGGAGTATTTCTTGCG |
PCR product length | 177 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |