KIAA0094

Product ID	ORK00014
Accession No	D42084
Description	methionyl aminopeptidase 1
Clone name	ha01451
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2671 bp) Predicted protein sequence (394 aa)
HaloTag ORF Clone	FHC00014
Flexi ORF Clone	FXC00014
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0094 by Kazusa Mouse cDNA Project

Length: 2671 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1485 bp
Genome contig ID	gi89161207f_100035903
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TAATGTGTAAAGGGAGATTAAAAAGTTTGAATGAT
Flanking genome sequence (167075 - 167124)	----+--------+--------+--------+--------+----* TATCCTACCATGTAGTCATTAACTTTGCTGCATTTCTTTGGGATTTCAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	100135903	100202976	11	100.0	Perfect prediction

Length: 394 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001099172	2.5e-171	99.5	methionyl amino...	Macaca mulatta
P53582	2e-168	100.0	Methionine amin...	Homo sapiens
Q5RBF3	2.3e-168	99.7	Methionine amin...	Pongo abelii
A6QLA4	1.6e-166	98.2	Methionine amin...	Bos taurus
Q8BP48	2.9e-166	98.2	Methionine amin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001714	201	214	PR00599	Peptidase M24
	IPR001714	223	239	PR00599	Peptidase M24
	IPR001714	293	305	PR00599	Peptidase M24
	IPR001714	324	336	PR00599	Peptidase M24
HMMPfam	IPR000994	145	381	PF00557	Peptidase M24
HMMTigr	IPR002467	136	382	TIGR00500	Peptidase M24A
ScanRegExp	IPR002467	299	317	PS00680	Peptidase M24A

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CCCCCTTTCTTCCCTTTTCTG
Primer_r	GGACAACTGCTGAAAGGAACG
PCR product length	323 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles