KIAA0109

Product ID	ORK00018
Accession No	D63475
Description	adaptor-related protein complex 2, mu 1 subunit, transcript variant 1
Clone name	ha01466
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1868 bp) Predicted protein sequence (438 aa)
HaloTag ORF Clone	FHC00018
Flexi ORF Clone	FXC00018
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0109 by Kazusa Mouse cDNA Project

Length: 1868 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	474 bp
Genome contig ID	gi89161205f_185275399
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTCCAGTTACAAACCCAATAAACTCTGTAGAGTGG
Flanking genome sequence (109175 - 109224)	----+--------+--------+--------+--------+----* AGTTGCTGGCTTAGTGTTGATGTGGGAGCTACATGGGGAGGGAACTGGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	185375399	185384572	11	99.3	Perfect prediction

Length: 438 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P84092	1e-187	100.0	AP-2 complex su...	Rattus norvegicus
CAH93147	1.9e-187	99.8	hypothetical pr...	Pongo abelii
AAA93254	1.9e-187	99.8	assembly protei...	Homo sapiens
XP_001363377	2.3e-187	99.8	similar to Adap...	Monodelphis dom...
CAH92511	2.7e-187	99.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001392	15	35	PR00314	Clathrin adaptor
	IPR001392	101	128	PR00314	Clathrin adaptor
	IPR001392	164	192	PR00314	Clathrin adaptor
	IPR001392	246	273	PR00314	Clathrin adaptor
	IPR001392	315	330	PR00314	Clathrin adaptor
	IPR001392	355	366	PR00314	Clathrin adaptor
HMMPfam	IPR008968	162	438	PF00928	Clathrin adaptor
ProfileScan	IPR008968	170	438	PS51072	Clathrin adaptor
ScanRegExp	IPR001392	162	182	PS00990	Clathrin adaptor
ScanRegExp	IPR001392	266	280	PS00991	Clathrin adaptor

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGCTTTGCTGCCTTCCCTTTG
Primer_r	ACAGACAGGTGGATGGGAGAG
PCR product length	138 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles