KIAA0095

Product ID	ORK00015
Accession No	D42085
Description	nucleoporin 93kDa, transcript variant 1
Clone name	ha01471
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2681 bp) Predicted protein sequence (832 aa)
HaloTag ORF Clone	FHC00015
Flexi ORF Clone	FXC00015
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0095 by Kazusa Mouse cDNA Project

Length: 2681 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	155 bp
Genome contig ID	gi51511732f_55221573
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATTTTTGTCAACGCCAATAAATTTCTTTGATTTGT
Flanking genome sequence (214606 - 214655)	----+--------+--------+--------+--------+----* ATTTCTTTTCAACATTCTTTTATTTTCTTTTTTTTTTTCTTTGAAATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	55321573	55436177	22	99.9	Perfect prediction

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510982	99.9	nucleoporin 93k...	Pan troglodytes
Q8N1F7	100.0	Nuclear pore co...	Homo sapiens
AAH34346	99.9	Nucleoporin 93k...	Homo sapiens
BAF84951	99.8	unnamed protein...	Homo sapiens
Q5R822	99.5	Nuclear pore co...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007231	244	518	PF04097	Nucleoporin interacting component

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 16

Experimental conditions

Panel name	Stanford G3
Primer_f	ACAAGTCCATCCTCGTCATCC
Primer_r	ACAAAACCAGAAACCCCAGCC
PCR product length	250 (3.0k) bp
PCR conditions	95 °C15 sec66 °C120 sec30 cycles