Order Kazusa clone(s) from : ![]() |
Product ID | ORK00015 |
---|---|
Accession No | D42085 |
Description | nucleoporin 93kDa, transcript variant 1 |
Clone name | ha01471 |
Vector information | |
cDNA sequence | DNA sequence (2681 bp) Predicted protein sequence (832 aa) |
HaloTag ORF Clone |
FHC00015
![]() |
Flexi ORF Clone | FXC00015 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0095
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 155 bp |
---|---|
Genome contig ID | gi51511732f_55221573 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (214606 - 214655) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | f | 55321573 | 55436177 | 22 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | ACAAGTCCATCCTCGTCATCC |
Primer_r | ACAAAACCAGAAACCCCAGCC |
PCR product length | 250 (3.0k) bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |