Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK07716 |
---|---|
Accession No | D50913 |
Description | peptidase (mitochondrial processing) alpha, transcript variant 1 |
Clone name | ha01523s1 |
Vector information | |
cDNA sequence | DNA sequence (2083 bp) Predicted protein sequence (528 aa) |
HaloTag ORF Clone |
FHC07716
|
Flexi ORF Clone | FXC07716 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0123
by Kazusa Mouse cDNA Project
|
Note | We replaced ha01523, former representative clones for KIAA0123 with ha01523s1. (2008/8/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 496 bp |
---|---|
Genome contig ID | gi89161216f_138324933 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (113102 - 113151) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Panel name | Stanford G3 |
---|---|
Primer_f | TTCCCGTGCGTGTTAGTTTGG |
Primer_r | TTCACCTGCTTCCTGGCTTGC |
PCR product length | 279 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |