KIAA0070

Product ID	ORK00395
Accession No	D31890
Description	lysyl-tRNA synthetase, transcript variant 2
Clone name	ha01530
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1970 bp) Predicted protein sequence (601 aa)
HaloTag ORF Clone	FHC00395
Flexi ORF Clone	FXC00395
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0070 by Kazusa Mouse cDNA Project

Length: 1970 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	162 bp
Genome contig ID	gi51511732r_74119132
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- AGACAAGGAATTAAAAATTTCTTTTTAATCCTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCAAATAAGCCATTTGTCTCTTCTCTTTACTTTTAGAATATCAACTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	74219132	74239052	14	99.9	Perfect prediction

Length: 601 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511115	99.7	lysyl-tRNA synt...	Pan troglodytes
BAG09591	100.0	lysyl-tRNA synt...	synthetic construct
Q15046	99.8	Lysyl-tRNA synt...	Homo sapiens
XP_001104312	96.8	lysyl-tRNA synt...	Macaca mulatta
EAW95621	96.5	lysyl-tRNA synt...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002313	263	273	PR00982	Lysyl-tRNA synthetase
	IPR002313	279	295	PR00982	Lysyl-tRNA synthetase
	IPR002313	308	321	PR00982	Lysyl-tRNA synthetase
	IPR002313	326	343	PR00982	Lysyl-tRNA synthetase
	IPR002313	462	478	PR00982	Lysyl-tRNA synthetase
HMMPfam	IPR004365	130	210	PF01336	Nucleic acid binding
HMMPfam	IPR004364	226	579	PF00152	Aminoacyl-tRNA synthetase
HMMTigr	IPR002313	76	581	TIGR00499	Lysyl-tRNA synthetase
ProfileScan	IPR006195	248	579	PS50862	Aminoacyl-tRNA synthetase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTAAATGGCACCGCTCTAAAG
Primer_r	TCAGTGGTTGCTACATTCTCC
PCR product length	340 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles