KIAA0124

Product ID	ORK04281
Accession No	D50914
Description	block of proliferation 1
Clone name	ha01534
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2108 bp) Predicted protein sequence (682 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0124 by Kazusa Mouse cDNA Project

Length: 2108 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	59 bp
Genome contig ID	gi51511724r_145288996
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGGTCGTGCTGAAGTCAACAGAGCCTTTACCCTG
Flanking genome sequence (167873 - 167824)	----+--------+--------+--------+--------+----* TGCTGCCTGGTGCTCCCACCTTCTTGAATTGGGGTTGCCAACAAAGCCGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	145456869	145483700	15	99.9	Perfect prediction

Length: 682 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH05160	99.9	BOP1 protein [H...	Homo sapiens
AAH07274	99.9	Similar to bloc...	Homo sapiens
Q14137	99.9	Ribosome biogen...	Homo sapiens
BAF83366	99.6	unnamed protein...	Homo sapiens
BAG37981	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	344	378	PD000018	WD40 repeat
HMMPfam	IPR012953	80	338	PF08145	BOP1
	IPR001680	339	377	PF00400	WD40 repeat
	IPR001680	506	542	PF00400	WD40 repeat
	IPR001680	546	584	PF00400	WD40 repeat
	IPR001680	589	627	PF00400	WD40 repeat
	IPR001680	644	682	PF00400	WD40 repeat
HMMSmart	IPR001680	338	377	SM00320	WD40 repeat
	IPR001680	380	419	SM00320	WD40 repeat
	IPR001680	458	501	SM00320	WD40 repeat
	IPR001680	504	542	SM00320	WD40 repeat
	IPR001680	545	584	SM00320	WD40 repeat
	IPR001680	588	627	SM00320	WD40 repeat
	IPR001680	639	682	SM00320	WD40 repeat
ProfileScan	IPR001680	345	386	PS50082	WD40 repeat
	IPR001680	345	386	PS50294	WD40 repeat
	IPR001680	511	682	PS50294	WD40 repeat
	IPR001680	595	625	PS50082	WD40 repeat
ScanRegExp	IPR001680	364	378	PS00678	WD40 repeat

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ATGATGACGAAGGCGACGAGG
Primer_r	GCTGTCCTCCGCATACTCATC
PCR product length	219 (0.3k) bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles