KIAA0060

Product ID	ORK00008
Accession No	D31766
Description	glucosamine-6-phosphate deaminase 1
Clone name	ha01541
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2613 bp) Predicted protein sequence (317 aa)
HaloTag ORF Clone	FHC00008
Flexi ORF Clone	FXC00008
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0060 by Kazusa Mouse cDNA Project

Length: 2613 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1342 bp
Genome contig ID	gi51511721r_141260427
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- ACAATGTGATATTTTCTATTAAATCCAGTATTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAAATAACATGTCATTTGTGGATTTGAGCCCCCAATTTTAGAAGACTCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	141360427	141372722	8	98.8	Perfect prediction

Length: 317 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P46926	3.3e-125	100.0	Glucosamine-6-p...	Homo sapiens
BAF83375	8.6e-125	99.7	unnamed protein...	Homo sapiens
Q5R8T8	8.6e-125	99.7	Glucosamine-6-p...	Pongo abelii
A4FV08	2.9e-123	97.9	Glucosamine-6-p...	Bos taurus
XP_001504008	1e-122	97.9	similar to gluc...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006148	43	278	PF01182	Glucosamine/galactosamine-6-phosphate isomerase
HMMTigr	IPR004547	29	287	TIGR00502	Glucosamine-6-phosphate isomerase
ScanRegExp	IPR004547	153	171	PS01161	Glucosamine-6-phosphate isomerase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TCCTTACACGCACTGATTTTC
Primer_r	CTGTGAAAGTGGAAGAAGGAA
PCR product length	228 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles