KIAA0119

Product ID	ORK00414
Accession No	D17793
Description	aldo-keto reductase family 1, member C3, transcript variant 1
Clone name	ha01753
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1204 bp) Predicted protein sequence (325 aa)
HaloTag ORF Clone	FHC00414
Flexi ORF Clone	FXC00414
Source	Myeloblast cell line (KG-1)

Length: 1204 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	181 bp
Genome contig ID	gi89161187f_5026586
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- GCCAGAAAGACAATAAATTTTTATCATTTTGAAAT
Flanking genome sequence (113292 - 113341)	----+--------+--------+--------+--------+----* AATTGAATGTTTTCTCAAAGATTCTTTACCTACTCTGTTCTGTAGTGTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	5126586	5139876	9	99.6	Perfect prediction

Length: 325 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P42330	9.8e-141	100.0	Aldo-keto reduc...	Homo sapiens
1S1P	1e-140	100.0	Crystal structu...	Homo sapiens
AAH01479	2.5e-140	99.7	Aldo-keto reduc...	Homo sapiens
AAP36169	2.5e-140	99.7	aldo-keto reduc...	synthetic construct
AAD14011	4.8e-140	99.4	chlordecone red...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001395	11	325	PD000288	Aldo/keto reductase
FPrintScan	IPR001395	43	67	PR00069	Aldo/keto reductase
	IPR001395	103	121	PR00069	Aldo/keto reductase
	IPR001395	153	170	PR00069	Aldo/keto reductase
	IPR001395	189	218	PR00069	Aldo/keto reductase
	IPR001395	237	261	PR00069	Aldo/keto reductase
HMMPfam	IPR001395	12	303	PF00248	Aldo/keto reductase
ScanRegExp	IPR001395	47	64	PS00798	Aldo/keto reductase
	IPR001395	153	170	PS00062	Aldo/keto reductase
	IPR001395	270	285	PS00063	Aldo/keto reductase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	AGGAGAAGCAGCAGCAAA
Primer_r	TGCATAGGTGCCAAATCC
PCR product length	124 bp
PCR conditions	95 °C15 sec60 °C120 sec30 cycles