KIAA0035

Product ID	ORK00378
Accession No	D21262
Description	nucleolar and coiled-body phosphoprotein 1, transcript variant 1
Clone name	ha01976
Vector information	The cDNA fragment was inserted at the NotI-EcoRV site of the ... The cDNA fragment was inserted at the NotI-EcoRV site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The cDNA was cloned into the vector in the direction of SacI site to KpnI site of the vector. The NotI sites at the both 5'- and 3'-end of the cDNA were disrupted by the vector ligation.
cDNA sequence	DNA sequence (3727 bp) Predicted protein sequence (707 aa)
HaloTag ORF Clone	FHC00378
Flexi ORF Clone	FXC00378
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0035 by Kazusa Mouse cDNA Project

Length: 3727 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1601 bp
Genome contig ID	gi89161187f_103802166
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACTACAAAATAATAAACTGGCTGGTTTATAATGTG
Flanking genome sequence (111453 - 111502)	----+--------+--------+--------+--------+----* TCTTGGGAGTTTTATTATTGTGAGTCTAAACCCCTCCCACCCCCTACTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	103902162	103913617	13	99.3	Perfect prediction

Length: 707 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAA04803	2.1e-161	100.0	ORF [Homo sapiens].	Homo sapiens
BAG09575	2.1e-161	100.0	nucleolar phosp...	synthetic construct
EAW49716	8.3e-161	99.9	nucleolar and c...	Homo sapiens
XP_001170994	4.9e-158	98.3	similar to NOLC...	Pan troglodytes
XP_001112123	3.6e-150	94.1	similar to Nucl...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	630	707	PD015362	NULL
HMMPfam	IPR007718	609	704	PF05022	SRP40
ProfileScan	IPR006594	8	40	PS50896	LisH dimerisation motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GCCTTCATGGACGAGTTA
Primer_r	CTTTTACCATGCAGACTG
PCR product length	161 bp
PCR conditions	95 °C15 sec52 °C60 sec30 cycles