KIAA0084

Product ID	ORK00401
Accession No	D42043
Description	raftlin, lipid raft linker 1
Clone name	ha02022
Vector information	The cDNA fragment was inserted at the NotI-EcoRV site of the ... The cDNA fragment was inserted at the NotI-EcoRV site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The cDNA was cloned into the vector in the direction of SacI site to KpnI site of the vector. The NotI site at the 3'-end of the cDNA was disrupted by the vector ligation.
cDNA sequence	DNA sequence (2918 bp) Predicted protein sequence (648 aa)
HaloTag ORF Clone	FHC00401
Flexi ORF Clone	FXC00401
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0084 by Kazusa Mouse cDNA Project

Length: 2918 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	971 bp
Genome contig ID	gi89161205r_16232368
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTAGTTACTTACGGCAATAAATCATCTATGAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGCACCGTGAGGATTGAGTGTTTATCGTGTCACTAGGAACAGTCCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	16332368	16530154	10	100.0	Perfect prediction

Length: 648 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_516313	0	99.4	raft-linking pr...	Pan troglodytes
AAH51336	2.3e-216	99.7	Raftlin, lipid ...	Homo sapiens
BAG65235	1.6e-211	99.2	unnamed protein...	Homo sapiens
Q14699	1.6e-209	100.0	Raftlin; Raft-l...	Homo sapiens
AAO91814	1.8e-209	99.8	cell migration-...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 3

Experimental conditions

Panel name	Genebridge 4
Primer_f	CCCATGTATGCTGTGTTTATC
Primer_r	TAAACAAGAGAAGAGACAGGC
PCR product length	135 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles