KIAA0203

Product ID	ORK00035
Accession No	D86958
Description	RB1-inducible coiled-coil 1, transcript variant 1
Clone name	ha02320
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6614 bp) Predicted protein sequence (1593 aa)
HaloTag ORF Clone	FHC00035
Flexi ORF Clone	FXC00035
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0203 by Kazusa Mouse cDNA Project

Length: 6614 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1323 bp
Genome contig ID	gi51511724r_53597572
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTGACAAGTTAATGAATAAATGAACAAATGATTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATGTTTCTATTTAATCTTTCCATGACATCTTTATGCAAAGACTGTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	53697572	53789536	24	99.9	Perfect prediction

Length: 1593 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW86720	100.0	RB1-inducible c...	Homo sapiens
NP_001077086	99.9	Rb1-inducible c...	Homo sapiens
AAH17556	99.8	RB1-inducible c...	Homo sapiens
Q8TDY2	99.7	RB1-inducible c...	Homo sapiens
BAB69690	99.7	Rb1-inducible c...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	5.2e-05	21.8	KIAA0004
AB020673	6.6e-05	22.2	KIAA0866

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTGAGTGATTGCTGGGAAGTG
Primer_r	CTCATCCAACTCAACTAACTC
PCR product length	199 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles