Order Kazusa clone(s) from : ![]() |
Product ID | ORK00457 |
---|---|
Accession No | D86960 |
Description | lysophosphatidylglycerol acyltransferase 1 |
Clone name | ha02324 |
Vector information | |
cDNA sequence | DNA sequence (6253 bp) Predicted protein sequence (391 aa) |
HaloTag ORF Clone |
FHC00457
![]() |
Flexi ORF Clone | FXC00457 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0205
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4913 bp |
---|---|
Genome contig ID | gi89161185r_209884960 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99992 - 99943) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 209984952 | 210070737 | 8 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMSmart | IPR002123 | 116 | 232 | SM00563 | Phospholipid/glycerol acyltransferase |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 39 | ALMRFAFMVVNNLVAIPSYICYV | 61 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GTAAAGGGCTGGTCACACGTG |
Primer_r | GCTTCTTTTGGTGTTCACATC |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |