Gene/Protein Characteristic Table for KIAA0182
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05365
Accession No D80004
Description Gse1 coiled-coil protein
Clone name ha02329s1
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (7133 bp)
Predicted protein sequence (1157 aa)
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0182 by Kazusa Mouse cDNA Project
Note We replaced ha02329, former representative clones for KIAA0182 with ha02329s1. (2008/8/27)
Features of the cloned cDNA sequence
Description

Length: 7133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 3658 bp
Genome contig ID gi51511732f_84104459
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AACATCCAAAAAATAAAATCTTCCTAAATTATGTT
Flanking genome sequence
(162854 - 162903)
----+----*----+----*----+----*----+----*----+----*
AAGAGGAAAATCTTTTTTATGATATAAAACAAAGCCAAACAAAGAAAAGC
Features of the protein sequence
Description

Length: 1157 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_511150 0 98.2 hypothetical pr...
Pan troglodytes
XP_001082386 0 97.8 similar to gene...
Macaca mulatta
NP_001127945 0 99.9 genetic suppres...
Homo sapiens
AAH43094 0 89.5 Genetic suppres...
Mus musculus
Q3U3C9 0 89.5 Genetic suppres...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB020660 0.00064 22.7 KIAA0853
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name Genebridge 4
Primer_f CAAGATGGAGATGGTCAGCAC
Primer_r TAGCATGGTCTTCCTCAGGTC
PCR product length 199 bp
PCR conditions 95 °C15 sec68 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp