Order Kazusa clone(s) from : ![]() |
Product ID | ORK00033 |
---|---|
Accession No | D79986 |
Description | BCL2-associated transcription factor 1, transcript variant 1 |
Clone name | ha02373 |
Vector information | |
cDNA sequence | DNA sequence (5538 bp) Predicted protein sequence (929 aa) |
Flexi ORF Clone | FXC00033 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0164
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2522 bp |
---|---|
Genome contig ID | gi89161210r_136521419 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 136621419 | 136652682 | 13 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | AATAACTCACTGATACCTGCG |
Primer_r | ACACACCTAAAGAGTCATGGC |
PCR product length | 129 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |