KIAA0170

Product ID	ORK00441
Accession No	D79992
Description	mediator of DNA-damage checkpoint 1
Clone name	ha02399
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6940 bp) Predicted protein sequence (2090 aa)
HaloTag ORF Clone	FHC00441
Flexi ORF Clone	FXC00441
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0170 by Kazusa Mouse cDNA Project

Length: 6940 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	657 bp
Genome contig ID	gi89161210r_30675564
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- ACCTCTGTGATAAATAAATATTCACTCTGTGCCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGGTGTAGTGTAGTTTTTTAAAATGTCTAGGTCTCAAGACACAAACTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	30775564	30790936	14	99.4	Terminal No-hit

Length: 2090 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09636	100.0	mediator of DNA...	synthetic construct
Q14676	99.8	Mediator of DNA...	Homo sapiens
CAI41891	99.8	mediator of DNA...	Homo sapiens
CAM25929	99.8	mediator of DNA...	Homo sapiens
BAE78617	99.4	mediator of DNA...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	6.7e-05	21.5	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000253	55	125	PF00498	Forkhead-associated
	IPR001357	1907	1958	PF00533	BRCT
	IPR001357	1992	2029	PF00533	BRCT
HMMSmart	IPR000253	54	106	SM00240	Forkhead-associated
ProfileScan	IPR000253	55	101	PS50006	Forkhead-associated
ProfileScan	IPR001357	1893	1971	PS50172	BRCT

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGATTTGAGGGTCCAGTTATG
Primer_r	TCACAGAGGTCAAGCCGAAGC
PCR product length	156 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles