KIAA0165

Gene/Protein Characteristic Table for KIAA0165

Order Kazusa clone(s) from :

Product ID	ORK04916
Accession No	D79987
Description	extra spindle pole bodies homolog 1 (S. cerevisiae)
Clone name	ha02421
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6662 bp) Predicted protein sequence (2093 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0165 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 6662 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	161 bp
Genome contig ID	gi89161190f_51848384
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGATTTAACCTCAGTATAATAAAGATACATCATTT
Flanking genome sequence (125304 - 125353)	----+--------+--------+--------+--------+----* AAACCCTGTTTTGCGTAGTTTATCTGAGAACATTTAAAGACACGGCATGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	51948384	51973686	31	99.6	Perfect prediction

Features of the protein sequence

Description

Length: 2093 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14674	100.0	Separin; Separa...	Homo sapiens
EAW96681	99.8	extra spindle p...	Homo sapiens
NP_036423	99.8	extra spindle p...	Homo sapiens
XP_001103494	96.0	similar to extr...	Macaca mulatta
EAW96682	99.8	extra spindle p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005314	1681	2042	PF03568	Peptidase C50

Expression profile

Description

Northern blot

Experimental conditions

Primer_f
Primer_r
PCR conditions	test

RH mapping information

Description

Chromosome No. 12

Experimental conditions

Panel name	Genebridge 4
Primer_f	AGAAGGAGGCTGAAGAGTTGC
Primer_r	AAAAGGCAAACACAAAACAGC
PCR product length	102 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp