KIAA0225

Product ID	ORK06210
Accession No	D86978
Description	nucleoporin 205kDa
Clone name	ha02515
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6237 bp) Predicted protein sequence (2013 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0225 by Kazusa Mouse cDNA Project

Length: 6237 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	193 bp
Genome contig ID	gi89161213f_134806392
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTCACTAGTAAAAAATAAATACTTTTTAAAAAAAC
Flanking genome sequence (177647 - 177696)	----+--------+--------+--------+--------+----* AAAACAAATGTATGGTTAATCTTTTGATCTTTTATCTTTTGATCAGCATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	134893228	134984037	43	99.9	Perfect prediction

Length: 2013 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92621	100.0	Nuclear pore co...	Homo sapiens
EAW83856	99.9	nucleoporin 205...	Homo sapiens
XP_527899	99.7	nucleoporin 205...	Pan troglodytes
XP_001105911	99.3	nucleoporin 205...	Macaca mulatta
XP_532728	96.7	similar to Nucl...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	265	LDAVNLALLMALLYCFDISFIE	286	PRIMARY	22

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CCGTGCTTATGCTCTTCTATG
Primer_r	TGAGGATGGAACTAGGGGAAG
PCR product length	158 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles