KIAA1521

Product ID	ORK00243
Accession No	AB040954
Description	GTPase activating protein and VPS9 domains 1, transcript variant 1
Clone name	ha02560
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5309 bp) Predicted protein sequence (1484 aa)
HaloTag ORF Clone	FHC00243
Flexi ORF Clone	FXC00243
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA1521 by Kazusa Mouse cDNA Project
Note	We replaced fh14406 and fj01708, former representative clones for KIAA1521 with ha02560. (2002/5/10,2007/1/24)

Length: 5309 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	582 bp
Genome contig ID	gi89161216f_126963968
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCTGCAGATTCTAATAAACAAGGACTATTGCTGAT
Flanking genome sequence (201462 - 201511)	----+--------+--------+--------+--------+----* AGTAGGCTGTGACATACTGTCTTGTGAAATGGTTTCCTTGACAAAATTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	127063968	127165428	28	99.8	Perfect prediction

Length: 1484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14C86	100.0	GTPase-activati...	Homo sapiens
XP_537846	96.5	similar to GTPa...	Canis lupus fam...
XP_415380	91.1	similar to GTPa...	Gallus gallus
AAI14938	98.8	GAPVD1 protein ...	Homo sapiens
XP_863217	97.7	similar to GTPa...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001936	158	359	PF00616	Ras GTPase-activating protein
HMMPfam	IPR003123	1380	1482	PF02204	Vacuolar sorting protein 9
HMMSmart	IPR013995	1379	1484	SM00167	Vacuolar sorting protein 9
ProfileScan	IPR001936	150	359	PS50018	Ras GTPase-activating protein
ProfileScan	IPR003123	1344	1484	PS51205	Vacuolar sorting protein 9

Primer_f	TAGGTATGGAGTTTGATGGAC
Primer_r	GTATGAGCTATCCACTGTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-