Order Kazusa clone(s) from : ![]() |
Product ID | ORK00243 |
---|---|
Accession No | AB040954 |
Description | GTPase activating protein and VPS9 domains 1, transcript variant 1 |
Clone name | ha02560 |
Vector information | |
cDNA sequence | DNA sequence (5309 bp) Predicted protein sequence (1484 aa) |
HaloTag ORF Clone |
FHC00243
![]() |
Flexi ORF Clone | FXC00243 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA1521
by Kazusa Mouse cDNA Project
|
Note | We replaced fh14406 and fj01708, former representative clones for KIAA1521 with ha02560. (2002/5/10,2007/1/24) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 582 bp |
---|---|
Genome contig ID | gi89161216f_126963968 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (201462 - 201511) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 127063968 | 127165428 | 28 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001936 | 158 | 359 | PF00616 | Ras GTPase-activating protein |
IPR003123 | 1380 | 1482 | PF02204 | Vacuolar sorting protein 9 | |
HMMSmart | IPR013995 | 1379 | 1484 | SM00167 | Vacuolar sorting protein 9 |
ProfileScan | IPR001936 | 150 | 359 | PS50018 | Ras GTPase-activating protein |
IPR003123 | 1344 | 1484 | PS51205 | Vacuolar sorting protein 9 |
Primer_f | TAGGTATGGAGTTTGATGGAC |
---|---|
Primer_r | GTATGAGCTATCCACTGTTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |