KIAA0180

Product ID	ORK00446
Accession No	D80002
Description	protein O-fucosyltransferase 1, transcript variant 1
Clone name	ha02567s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5189 bp) Predicted protein sequence (403 aa)
HaloTag ORF Clone	FHC00446
Flexi ORF Clone	FXC00446
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0180 by Kazusa Mouse cDNA Project
Note	We replaced ha02567, former representative clones for KIAA0180 with ha02567s1. (2002/5/10)

Length: 5189 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3976 bp
Genome contig ID	gi51511747f_30159360
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- TCAAATATAAATAAAAAATTGTGAGTAATAAAATG
Flanking genome sequence (130743 - 130792)	----+--------+--------+--------+--------+----* AACTCACAGTTTCAACAATGACCCACATTTTACCAGTCTAGTTGCATTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	f	30259360	30290101	7	100.0	Perfect prediction

Length: 403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9H488	3e-174	100.0	GDP-fucose prot...	Homo sapiens
BAE88386	3.2e-171	97.9	unnamed protein...	Macaca fascicularis
CAH91412	3.7e-171	98.5	hypothetical pr...	Pongo abelii
AAQ02332	6.2e-164	92.1	protein O-fucos...	Bos taurus
CAH03714	1.2e-162	91.0	protein-O-fucos...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	19	AAWARPLSVSFLLLLLPLPGMP	40	PRIMARY	22

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AAGGAGGTGGGAAATGATTAG
Primer_r	AACAGGGAAAACATGATACAC
PCR product length	150 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles