KIAA1398

Product ID	ORK06702
Accession No	AB037819
Description	ribosome binding protein 1
Clone name	ha02572
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5468 bp) Predicted protein sequence (1586 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA1398 by Kazusa Mouse cDNA Project
Note	We replaced hk01703, former representative clones for KIAA1398 with ha02572. (2001/5/29)

Length: 5468 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	501 bp
Genome contig ID	gi51511747r_17442325
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- GTGTTGATGCCATTAAAACCAACGTTGGTGCCCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTGCGGTCTCGTCTGGTCTTCTGCTGGGGCTCCCCCACCCGCTGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	17542325	17610847	26	99.0	Both No-hit

Length: 1586 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10454	100.0	ribosome-bindin...	synthetic construct
BAF73807	97.2	p180/ribosome r...	Homo sapiens
Q9P2E9	90.2	Ribosome-bindin...	Homo sapiens
Q99PL5	79.3	Ribosome-bindin...	Mus musculus
CAM26890	78.0	ribosome bindin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13629	5.9e-10	26.1	KIAA0004
AB029041	0.00025	21.1	KIAA1118
AB007914	0.00087	24.9	KIAA0445

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	NULL	417	616	PD028462	NULL
HMMPfam	IPR007794	59	202	PF05104	Ribosome receptor lysine or proline rich
	IPR002989	257	296	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	327	366	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	367	406	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	427	466	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	477	516	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	537	576	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	577	616	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	617	656	PF01469	Mycobacterial pentapeptide repeat
	IPR002989	657	696	PF01469	Mycobacterial pentapeptide repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	34	TLGVVVFGGFMVVSAIGIFLVST	56	PRIMARY	23

Primer_f	AGTGAAGAACAATGACCTCCG
Primer_r	CTCGGTGTAATTCTGTTGTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ATGCAATTAGCTCCCTCCTCC
Primer_r	AGAGACTCCAACTATGCCATG
PCR product length	121 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles