KIAA0212

Product ID	ORK00461
Accession No	D86967
Description	ER degradation enhancer, mannosidase alpha-like 1
Clone name	ha02602
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6072 bp) Predicted protein sequence (666 aa)
HaloTag ORF Clone	FHC00461
Flexi ORF Clone	FXC00461
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0212 by Kazusa Mouse cDNA Project

Length: 6072 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4040 bp
Genome contig ID	gi89161205f_5104433
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TATGAGTAATTTTTATTAAAAGATTTCTTTTTTTG
Flanking genome sequence (132211 - 132260)	----+--------+--------+--------+--------+----* AGTTGTCATCTTGTTTCTTTTTTACATTCTCATGTACATTACATTACATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	5204433	5236642	12	99.3	Perfect prediction

Length: 666 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92611	100.0	ER degradation-...	Homo sapiens
XP_001098603	98.5	ER degradation ...	Macaca mulatta
AAI51306	95.1	EDEM1 protein [...	Bos taurus
Q925U4	92.3	ER degradation-...	Mus musculus
BAE30594	92.1	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001382	146	166	PR00747	Glycoside hydrolase
	IPR001382	192	206	PR00747	Glycoside hydrolase
	IPR001382	229	247	PR00747	Glycoside hydrolase
	IPR001382	283	302	PR00747	Glycoside hydrolase
	IPR001382	375	392	PR00747	Glycoside hydrolase
	IPR001382	443	459	PR00747	Glycoside hydrolase
	IPR001382	498	522	PR00747	Glycoside hydrolase
	IPR001382	557	577	PR00747	Glycoside hydrolase
HMMPfam	IPR001382	146	595	PF01532	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	LVLGLVLLRLGLHGVLWLVFGLG	37	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TACCCTCTTCCTTCTTTCTGC
Primer_r	TTTCCGTAAGTTTTCCCAGAG
PCR product length	171 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles