Order Kazusa clone(s) from : ![]() |
Product ID | ORK03291 |
---|---|
Accession No | D86963 |
Description | dishevelled segment polarity protein 3 |
Clone name | ha02713 |
Vector information | |
cDNA sequence | DNA sequence (5146 bp) Predicted protein sequence (748 aa) |
Flexi ORF Clone | FXC03291 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0208
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 185355978 | 185374092 | 15 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001158 | 35 | 120 | PD003639 | DIX |
FPrintScan | IPR008339 | 356 | 370 | PR01760 | Dishevelled region |
IPR008339 | 390 | 402 | PR01760 | Dishevelled region | |
IPR008339 | 485 | 495 | PR01760 | Dishevelled region | |
IPR008339 | 511 | 522 | PR01760 | Dishevelled region | |
IPR008342 | 531 | 541 | PR01763 | Dishevelled-3 protein | |
IPR008342 | 583 | 592 | PR01763 | Dishevelled-3 protein | |
IPR008342 | 617 | 628 | PR01763 | Dishevelled-3 protein | |
IPR008342 | 666 | 677 | PR01763 | Dishevelled-3 protein | |
HMMPfam | IPR001158 | 33 | 114 | PF00778 | DIX |
IPR003351 | 174 | 245 | PF02377 | Dishevelled protein | |
IPR001478 | 281 | 366 | PF00595 | PDZ/DHR/GLGF | |
IPR000591 | 454 | 526 | PF00610 | Pleckstrin/ G-protein | |
HMMSmart | IPR001158 | 33 | 114 | SM00021 | DIX |
IPR001478 | 290 | 369 | SM00228 | PDZ/DHR/GLGF | |
IPR000591 | 454 | 528 | SM00049 | Pleckstrin/ G-protein | |
ProfileScan | IPR001158 | 33 | 114 | PS50841 | DIX |
IPR001478 | 281 | 353 | PS50106 | PDZ/DHR/GLGF | |
IPR000591 | 454 | 528 | PS50186 | Pleckstrin/ G-protein |
Panel name | Genebridge 4 |
---|---|
Primer_f | AGCATGGGATTTGGAGTTAGG |
Primer_r | TTACATACGAGGGAACTGAGG |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |