KIAA0183

Product ID	ORK04947
Accession No	D80005
Description	family with sequence similarity 120A
Clone name	ha02726
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4904 bp) Predicted protein sequence (1111 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0183 by Kazusa Mouse cDNA Project

Length: 4904 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1566 bp
Genome contig ID	gi89161216f_95154038
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTACAATGCTTAATAAAAATCTTTATTCTTTTAGT
Flanking genome sequence (214174 - 214223)	----+--------+--------+--------+--------+----* ATAAAGTATGGCGTGGCTTTTAAATTCACTTGTAAAAGCTAATTTTATAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	95254038	95368210	18	99.5	Perfect prediction

Length: 1111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NZB2	100.0	Constitutive co...	Homo sapiens
EAW62864	99.9	chromosome 9 op...	Homo sapiens
XP_001056595	96.6	similar to Prot...	Rattus norvegicus
AAI58135	96.4	BC010304 protei...	Mus musculus
AAI67198	96.4	CDNA sequence B...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058741	1.6e-06	24.2	KIAA1838

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CACGTCAAGGTTGCACAGAGC
Primer_r	GTGCATAATCAGAGTCATACG
PCR product length	106 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles