Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01962 |
---|---|
Accession No | D80010 |
Description | lipin 1, transcript variant 1 |
Clone name | ha02734 |
Vector information | |
cDNA sequence | DNA sequence (5307 bp) Predicted protein sequence (899 aa) |
HaloTag ORF Clone |
FHC01962
|
Flexi ORF Clone | FXC01962 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0188
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2606 bp |
---|---|
Genome contig ID | gi89161199f_11723109 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (161868 - 161917) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 11804230 | 11884975 | 20 | 99.5 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GCAAGGCTGGCATATTAACAC |
Primer_r | AGGGCAACTTTGAAATGTGTG |
PCR product length | 173 bp |
PCR conditions | 95 °C15 sec60 °C60 sec30 cycles |