Order Kazusa clone(s) from : ![]() |
Product ID | ORK01056 |
---|---|
Accession No | D80001 |
Description | ribosomal RNA processing 1B |
Clone name | ha02738 |
Vector information | |
cDNA sequence | DNA sequence (4994 bp) Predicted protein sequence (762 aa) |
HaloTag ORF Clone |
FHC01056
![]() |
Flexi ORF Clone | FXC01056 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0179
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2705 bp |
---|---|
Genome contig ID | gi51511750f_43803908 |
PolyA signal sequence (ATTAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (136480 - 136529) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 21 | f | 43903908 | 43940386 | 16 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | GTTGCAGGTGTTGGGAGGAAG |
Primer_r | ATTGGACTTGGCTTTGACGAG |
PCR product length | 158 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |