KIAA0211

Product ID	ORK00460
Accession No	D86966
Description	zinc finger protein 592
Clone name	ha02768
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5086 bp) Predicted protein sequence (1317 aa)
HaloTag ORF Clone	FHC00460
Flexi ORF Clone	FXC00460
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0211 by Kazusa Mouse cDNA Project

Length: 5086 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	712 bp
Genome contig ID	gi51511731f_82992584
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CTCAGACTATATTTCAAATAAAAAATCTTCTCACC
Flanking genome sequence (154948 - 154997)	----+--------+--------+--------+--------+----* ATGCAGGTAGGCTCTTGTATTCCTCTCCAAGTGAGCCTGGCCCCACCCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	83092584	83147530	12	99.6	Perfect prediction

Length: 1317 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001084237	97.6	zinc finger pro...	Macaca mulatta
AAH94688	100.0	Zinc finger pro...	Homo sapiens
Q92610	99.9	Zinc finger pro...	Homo sapiens
EAX01959	99.5	zinc finger pro...	Homo sapiens
XP_001916274	91.5	zinc finger pro...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046849	8e-38	40.2	KIAA1629
AB037862	8e-13	36.1	KIAA1441

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	942	965	PF00096	Zinc finger
	IPR007087	1063	1086	PF00096	Zinc finger
	IPR007087	1203	1226	PF00096	Zinc finger
HMMSmart	IPR015880	637	662	SM00355	Zinc finger
	IPR015880	665	689	SM00355	Zinc finger
	IPR015880	761	781	SM00355	Zinc finger
	IPR015880	790	812	SM00355	Zinc finger
	IPR015880	818	842	SM00355	Zinc finger
	IPR015880	849	872	SM00355	Zinc finger
	IPR015880	877	900	SM00355	Zinc finger
	IPR015880	942	965	SM00355	Zinc finger
	IPR015880	1033	1056	SM00355	Zinc finger
	IPR015880	1063	1086	SM00355	Zinc finger
	IPR015880	1093	1119	SM00355	Zinc finger
	IPR015880	1174	1196	SM00355	Zinc finger
	IPR015880	1203	1226	SM00355	Zinc finger
ProfileScan	IPR007087	637	662	PS50157	Zinc finger
	IPR007087	790	817	PS50157	Zinc finger
	IPR007087	942	970	PS50157	Zinc finger
	IPR007087	1063	1091	PS50157	Zinc finger
ScanRegExp	IPR007087	792	814	PS00028	Zinc finger
	IPR007087	879	900	PS00028	Zinc finger
	IPR007087	944	965	PS00028	Zinc finger
	IPR007087	1035	1056	PS00028	Zinc finger
	IPR007087	1065	1086	PS00028	Zinc finger
	IPR007087	1205	1226	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AGCTCTGCCTAGTCTGGTTTG
Primer_r	CAAATGGCACGAGAGCAGTAC
PCR product length	142 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles