KIAA0207

Product ID	ORK00458
Accession No	D86962
Description	growth factor receptor-bound protein 10
Clone name	ha02795
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5431 bp) Predicted protein sequence (605 aa)
HaloTag ORF Clone	FHC00458
Flexi ORF Clone	FXC00458
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0207 by Kazusa Mouse cDNA Project

Length: 5431 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2883 bp
Genome contig ID	gi89161213r_50525260
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TGTAATTAGAAATAAACATTAATACAGTGTTCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTCTATTGCTGGTGATATCTGTTTCTAATTTTAAAACACTGGCCAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	50625260	50828160	18	99.4	Perfect prediction

Length: 605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09655	100.0	growth factor r...	synthetic construct
EAL23897	99.8	growth factor r...	Homo sapiens
XP_001154856	99.5	similar to grow...	Pan troglodytes
Q13322	99.7	Growth factor r...	Homo sapiens
XP_001154916	99.3	growth factor r...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051468	5.9e-18	28.0	KIAA1681

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000980	504	600	PD000093	SH2 motif
FPrintScan	IPR000980	504	518	PR00401	SH2 motif
	IPR000980	525	535	PR00401	SH2 motif
	IPR000980	574	588	PR00401	SH2 motif
HMMPfam	IPR000159	177	261	PF00788	Ras-association
	IPR001849	302	410	PF00169	Pleckstrin-like
	IPR015042	434	483	PF08947	BPS (Between PH and SH2)
	IPR000980	504	585	PF00017	SH2 motif
HMMSmart	IPR000159	177	261	SM00314	Ras-association
	IPR001849	302	412	SM00233	Pleckstrin-like
	IPR000980	502	591	SM00252	SH2 motif
ProfileScan	IPR000159	177	261	PS50200	Ras-association
	IPR001849	301	410	PS50003	Pleckstrin-like
	IPR000980	504	600	PS50001	SH2 motif

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TGCCAGACACTCCCAAATCCC
Primer_r	AATCCGCGAGCCCTCAACTTG
PCR product length	120 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles