KIAA0197

Product ID	ORK01059
Accession No	D83781
Description	nucleoporin 160kDa
Clone name	ha03030
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4814 bp) Predicted protein sequence (1314 aa)
HaloTag ORF Clone	FHC01059
Flexi ORF Clone	FXC01059
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0197 by Kazusa Mouse cDNA Project

Length: 4814 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	868 bp
Genome contig ID	gi51511727r_47656365
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TTGGATTTTATTCTGTATATTAAAATTTATCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGAAACAATCTGTATACTACTTGCTTGTATAGCCTTTTGACCCTTCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	47756365	47826441	34	99.7	Perfect prediction

Length: 1314 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA12110	100.0	nuclear pore pr...	Homo sapiens
BAG11151	100.0	nucleoporin 160...	synthetic construct
Q12769	99.9	Nuclear pore co...	Homo sapiens
EAW67878	99.5	nucleoporin 160...	Homo sapiens
EAW67883	99.0	nucleoporin 160...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR000560	1047	1061	PS00616	Histidine acid phosphatase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GTGCTTGCTGGTGGTGCTAAC
Primer_r	TACAACAAGCCAACAACCCTC
PCR product length	185 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles